* = tied for number of citations

** = some mutant alleles have kernel phenotypes.

If you want to become one of the famous mutant corn genes, it helps if you have an effect that is visible in corn kernels instead of only from fully grown plants.

And here is why:

• A geneticist could determine that the version of c1 that creates yellow kernels is recessive to the version that creates purple kernels just from looking at the ear of corn on left.
• Furthermore, they could tell you that both the male parent (the plant that provided the pollen) and the female parent (the plant on which the ear of corn grew) were both heteryzygous for the c1 genes (they each had one dominant version of the genes and one recessive version), and therefore the corn kernels the parent plants were grown from were both purple.
• They would know with certainty that all of the yellow kernels contain two recessive versions of the c1 gene.
• While they couldn’t predict with absolute certainty whether a specific purple corn kernel on that ear carried two dominant versions of the c1 gene or one dominant and one recessive version, they would know there was a 1/3 chance that kernel has two dominant copies, and a 2/3 chance it had one dominant and one recessive copy.
• That geneticist could make all sorts of predictions about what ears would look like in future generations depending on what colors of corn kernels were planted and which plants were mated with each other.

All this from a single picture of an ear of corn. For a phenotype seen in corn plants but not in kernels (like Knotted1), a geneticist would have to plant a row or more of corn seeds from an ear and examine the growing plants to get the same quantity of information.

And that is why mutations with kernel phenotypes have been so popular over a century of maize genetics research.

MAT points out another more pragmatic reason yellow corn may not be favored in Africa that I hadn’t heard of before. Apparently the extra carotenoids make yellow corn more susceptiable to spoilage than white corn varieties, a very pertenent issue in areas without access to the kinds of storage facilities we take for granted in American agriculture.

Jeremy at the Agricultural Biodiversity Weblog picked up the torch, highlighting a number of their own previous posts relevant to the discussion, including one by fellow blogger Luigi that relates the reaction of his own wife, originally from Kenya, on ordering polenta** at a restuarant and receiving a yellow dish.

Fortunately breeds of corn that contain even more beta carotene (the carotenoid most easily converted into vitamin A by our bodies) aren’t even yellow all the time. Although I wasn’t able to find a freely available picture, sometimes they’re ORANGE.*** While it turns out the correlation between color and beta carotene content isn’t perfect****, there’s still reason to hope varieties bred for the highest pre-vitamin A content will end up a striking orange color. For a visual examples of how orange corn can get, check out check out Dr. Rocheford’s lab website.

Will the distinction between orange and yellow***** be enough to get over the Africa’s lack of enthusiasm for yellow corn? Will the benefits of a diet with more vitamin A be enough to outweight the issues with yellow corn going “off” if stored improperly? I certainly hope the answers to both these questions are yes, but we won’t know for sure until we try. And there are some hopeful signs. For example this segment in a story from NPR:

Winter-Nelson and one of his graduate students took some of this orange corn to an open-air market in Mozambique for a taste test. The market-goers still preferred their white corn, but almost half of them agreed to exchange it for bags of orange corn when they heard it was more nutritious.”Probably the most encouraging part of it for me was that people who reported that they didn’t have much dietary diversity,” Winter-Nelson says. “People who reported that they didn’t eat very many fruits and vegetables, [or] that they very rarely ate animal products of any kind — eggs, meat, or chicken — were the most likely to take the trade.

“So, the ones who need it were attracted to it.”

So that’s a hopeful sign.

Two ears where some kernels received C1 from both parents, some from one parent and some from none. In a whole field full of C1 homozygotes, almost the kernels would be dark purple/black. Image courtesy of MaizeGDB and MG Neuffer

As I was proofing this post today, one other thing occurred to me. If the objection to yellow corn is primarily based on the color (let’s leave aside the issue of flavor for a moment), wouldn’t the simplest solution for the biofortified corn be to breed in an allele like C1 that turns corn kernels purple/black? There’d be absolutely no chance of the corn being mistaken for normal yellow corn, and since C1 acts on the production of anthocyanins, a completely different kind of plant pigments, it shouldn’t impact the level of beta carotene in the biofortified corn. Please point out in the comments if I’ve missed something obvious.

*This isn’t to say the food aid itself is unpopular, only that people prefer not to eat corn that resembles it when they’re NOT starving.

**A dish made of boiled corn meal, see photo below. A few years ago my mother discovered a lasagna recipe that substituted well cooked polenta for lasagna nuddles. About which, all I can say is that if you otherwise couldn’t eat lasagna (for example people who avoid eating gluten found in grains like wheat, barley, and rye by choice or necessity), polenta lasagna is a lot better than no lasagna at all.

Polenta. photo: Marilyn M., flickr (click to see photo in its original context)

***The amazing genetic diversity of maize also means these varietes can be produced without the need for genetic engineering. Which means getting the seeds to those would could most benefit from them would be faster and cheaper than something like golden rice which governments will hopefully approve someday.

****Harjes, C.E., Rocheford, T.R., Bai, L., Brutnell, T.P., Kandianis, C.B., Sowinski, S.G., Stapleton, A.E., Vallabhaneni, R., Williams, M., Wurtzel, E.T., Yan, J.B. and Buckler, E.S. (2008). Natural genetic variation in lycopene epsilon cyclase tapped for maize biofortification. Science DOI: 10.1126/science.1150255

****It occurs to me one factor in whether the distinction between yellow and orange is important may turn out to be whether different local languages contain a word for orange. Languages have been studied that contain as few as two words for colors (roughly: dark and light) and a color name describing orange is almost never found in languages with less than 7 color names. … sorry a distribution requirements class that I had to take in college just became arguable relevant. This is exciting!

A stalk of brussels sprouts photo credit: cbmd, flickr (click for photo in original context)

Last week Greg over at Pie-ence was talking about the amazing variety of vegetable crops breed out of a handful of species within the genus Brassica, specifically Brassica rapa and Brassica oleracea.* I’m referring to these as cruciferous vegetables, which is actually a wider category including all the vegetables within the mustard family of plants (scientifically this is called the Brassicaceae). But one of the cool things about having so many kinds of vegetables within the same couple of species is that, because they’re the same species, they can still be interbreed with each other to create “new”** vegetables.

I still remember the first time I saw such a new vegetables, the broccoflower***. I didn’t even LIKE vegetables back then but I was still fascinated by this strange new plant in the produce aisle. Needless to say, others didn’t share my excitement as the broccoflower did not, in fact end up taking the world by storm (I’m not bitter!), although I do still spot them from time to time at the grocery store. I was able to dig up this very enthusiastic article on the broccoflower from twenty years ago. The internet is a wonderful thing.

The internet is also responsible for telling me about the latest development in cruciferous vegetables. The “flower sprout”, the result of breeding work using brussels sprouts and kale, both breeds of the species Brassica oleracea. Right now they’re only available in England, otherwise I’d have tried it already. How could I resist a vegetable described as:

“a purple and green triffid-like crop”

Assorted colorful cauliflowers (orange ones make lots carotenoids the group of molecules that includes pre-vitamin A, the purple ones make anthocyanins another kind of plant pigment). photo: Le Grande Farmers' Market, flickr (click to see photo in its original context)

Both the links in the above paragraph are to stories that also contain pictures of the flower sprout.

I guess my point here is that plant breeders can produce all kinds of cool new vegetables given the chance. The limiting factor really is what people will buy, not the variability of plants.

*Brassica oleracea is responsible for Broccoli, Brussels sprouts, Cabbage, Cauliflower, Collard Greens, Kale, and Kohlrabi. Brassica rapa is responsible for Bok choy, Komatsuna, Mizuna, Rapini, Chinese cabbage, and Turnips. And Brassica napus, a species that resulted from the hybridization of Brassica rapa and Bassica oleracea adds Rutabaga and Canola (not a vegetable, but a key crop none the less) to the count.

**I’m putting new in quotes throughout this article because I don’t know what the actual definition of what makes vegetable different enough to qualify as a new type is.

An Arabidopsis flower (also a member of the mustard family that produces so many kinds of vegetables). The name cruciferous vegetables comes from the pattern of four petals. Apparently it looks like a cross to some people, hence cruciferous. In Arabidopsis the flowers are only a few millimeters big. photo: BlueRidgeKitties, flickr (click to see the photo in its original context)

***From everything I was able to read the broccoflower really is the result of a cross between broccoli and cauliflower (followed by many more generations of selective breeding of course). It is generally lumped in with the cauliflowers because its head is made of up inflorescence stem tissue, while broccoli heads are made up of immature flower buds. Cauliflower plants (and broccoflower plants) have broken copies of the CAL gene, which (when it isn’t broken) is helps the plant decide to switch from producing stems that were bear flowers to the flowers themselves. Without a functional version of CAL, cauliflowers just keep making denser and denser stems, producing the distinctive heads of cauliflower. If you have journal access, you can read more about the CAL gene at this science paper: http://dx.doi.org/10.1126/science.7824951

Since the effect of breaking this gene suggests to me that it is probably a recessive mutation (it won’t have an effect on the plant unless the plant inherits a broken copy from both parents) I imagine developing the broccoflower involved mating the offspring of a broccoli / cauliflower mating and mating them with normal cauliflowers again, since plants with one cauliflower and one broccoli parent should inherit a working copy of the CAL gene from their dad (or mom) the broccoli. But this last paragraph is purely my own speculation.

A genetic map describes the order of markers along the chromosomes of a genome. In the oldest maps, these markers would be whole genes. Because genes that are closer together are more likely to be inherited together** by looking at the patterns of inheritance one can figure out the genetic distance between different genes.*** For example (genetic map of maize). Modern genetic maps use smaller markers, often changes in a single nucleotide (say an A turning into T or a C turning into a G) called a single nucleotide polymorphism (or SNP) between different individuals of the same species, but the principle is the same. It’s a map of the order landmarks on a chromosome along with some kind of information that can be used to tell them apart (differences in the DNA sequence itself or differences in the plants, animals, or people that carry different version of the gene).

A genome on the other hand, is the DNA sequence of each chromosome (although usually with the occasional gap). For example:

gggcactttttcgcgtttgcaagttcatggacctaagtggcacaggcgg

acaagttcaggggtcattttttcgggtttgcaagttcatggaccaaagtg

a 100 base pair segment from Sorghum bicolor chromosome 1. Of course sorghums chromosome 1 alone is more than 700,000 times as long, but to the human eye, one piece of raw sequence looks a lot like another. That’s why a genome sequence should also include data which describes which parts of the sequence actually code for genes and which parts don’t. And the end result is the data needed for a tool like CoGe to do this sort of analysis.

Yes I know I'm re-using images, but I'm just fascinated with the soybean genome this month. This compares similar sequences in four regions of the soybean genome. Notice the gene models drawn in green and blue. They were just as much a part of the soybean genome published last week as the raw sequence itself, and allow us to make much more sense out of that raw sequence. Play with this data yourself at: http://tinyurl.com/ydh95oh

For basic science today, a genome sequence is generally more useful than a genetic map. That hasn’t always been true. Barbara McClintock published a map of the order of three genes and the fact they were genetically linked to a physically observable feature on one of the maize chromosomes back in 1931****, more than twenty years before the structure of DNA was discovered. Even today, from a breeding or crop improvement perspective, a genetic map is probably more important than an actual sequenced genome, especially from a cost/benefit perspective.*****

So there’s my best attempt to explain the differences between a genetic map and a genome. But let me leave you with one final metaphor. Imagine a genetic map as the default view in google maps. It tells you were various things are located and how to get from point A to point B. A genome sequence is like clicking the “Satellite View” button. It tells you not just where things are, but what they look like, but costs a lot more to obtain (salaries of cartagraphers vs developing a space program and sending satellites into orbit).  Similarly, maps can be used to help piece satellite photos together into coverage of whole countries, and satellite photos can error check and improve the accuracy of maps.

*Artemisia annua is a kind of wormwood. Another species in the genus Artemisia absinthium provided the flavoring for absinthe, but annua‘s claim to fame is that it produces artemisinin, a crucial ingredient in next generation anti-malarial drugs that is in very short supply given annua‘s poor characteristics as a crop. A genetic map of the species holds promise for breeding new varieties that would increase production (and hopefully reduce the costs) of these life saving drugs. I’ve also got to mention that Jay Keasling, a synthetic biologist at JBEI and associated with Berkeley has engineered E. coli to produce artemisinin, with the goal of producing it much more cheaply in bioreactors than it can be harvested from plants grown in the field. It’ll be interesting to see how these two approaches play out.

**It has to do with the way the two copies of each chromosome, one inherited from each parent, are mixed together before they get passed down another generation.

***Genetic distance is measured in centi-morgans which correspond to the chances that genes won’t be inherited together. Let me put that another way. Two genes 1 centimorgan apart will be inherited 99% of the time. Two genes 25 centimorgans apart will be inherited together 75% of the time. This only hold true up to 50 centimorgans where genes are inherited together 50% of the time (this is the same as random chance or two genes on separate chromosomes) so the only way to connect genes farther than 50 centimorgans apart with mapping is to join them together based on mapping how far each gene is from to some gene in the middle. Connect enough genes together and you’ve mapped a whole chromosome. But the biggest thing to keep in mind is that centimorgans aren’t convertible into actual lengths of DNA sequence both because different species mix their chromosomes different amounts, and because different parts of a chromosome are more likely to mix (called recombining) than others. A genetic map and a genome sequence will agree on the order of genes, but not the distances between them.

****McClintock, Barbara The order of the genes C, Sh, and Wx in Zea mays with reference to a cytologically known point in the chromosome. Proceedings of the National Academy of Sciences 15 August 1931

*****Having a sequenced genome can really speed up marker discovery for building genetic maps, and genetic maps are often created during genome assembly as a way to bridge together DNA sequences separated by unsequenced gaps, so investing in either one will make it easier to eventually have both.

CGIAR spending on research targeted at agriculture in Sub-Saharan Africa (178 million dollars a year in 2003) provides 1.3 million people with an escape from extreme poverty (living one dollar a day or less) every year. Simple division would indicate the agricultural research of the CGIAR centers is saving human beings from the trap of extreme poverty at a cost of just under 137 dollars per person. Of course it isn’t that simple, there are both economies of scale** and, eventually, diminishing margins of return*** to consider, but it seems the work of the CGIAR centers in Africa are big enough to have achieved those economies of scale, and, given their calculations on the elasticity on poverty to investment in agriculture, Africa is a LONG way from having to worry about diminishing marginal returns on agricultural investment.

Given the elasticity of poverty reduction to agricultural research spending they calculate (-.22) the marginal cost* of reducing poverty by another person in Sub-Saharan Africa through investments in agricultural research is only $71. (i.e. spending one billion dollars more on agricultural research would save an additional 14 million people from poverty.) This doesn’t consider the additional postive effects of improving local agriculture (for example reducing the incidence of famine).

Finally consider this quote from the paper for a sense of the work the CGIAR centers are funding and try not to feel as impressed as I do:

National and international agricultural research investments have generated a range of improved technologies, especially of modern varieties of the major food crops. A number of CGIAR centers have partnered with national programs and led major technology development efforts aimed at raising the yields of major food crops or averting yield losses that threatened the livelihoods of millions of Africans. The biological control of cassava mealybug in SSA led by IITA; high yielding, open-pollinated varieties (OPVs) of maize in West and Central Africa led by IITA and hybrids in Eastern and Southern Africa led by CIMMYT; high yielding and mosaic virus resistant cassava varieties in SSA led by IITA; high yielding wheat in Eastern and Southern Africa led by CIMMYT; hybrid sorghum in Sudan led by ICRISAT; semi-dwarf rice for irrigated regions in West Africa led by WARDA and IRRI; early maturing cowpeas in West Africa led by IITA; disease-resistant potatoes in Eastern and Central African highlands led by CIP; disease-resistant bean varieties in Kenya and Uganda led by CIAT; and improved fallows in Zambia led by ICRAF are now cited as outstanding success stories of technological change in food crop production in SSA. New varieties of potato, sweet potato, pearl millet, sorghum, groundnut, pigeon pea, soybean, chickpea, lentil, durum wheat, and barley have also increased the yields in areas where these were adopted.

*My training in economics is limited to introductory micro and macro economics courses, so I’m in no way qualified to evaluate the underlying calculations of this paper. The authors of the paper are also members of the International Institute for Tropical Agriculture, one of the 15 CGIAR centers, so they’ve got an interest in highlighting the results of increasing CGIAR funding. Weighing against those two points is the fact that their study was published in a peer reviewed journal, which required scientists trained in the same field of study but without connection to the authors to have read over the paper and had no major objections to data or reasoning presented by Drs Alene and Coulibaly.

**Setting up research centers, buying core equipment is expensive, but once the facilities are in place the cost of doing more research is much lower.

***Eventually all the easiest improvements to crops are made, so the cost of having an equal effect goes up because scientists are working with traits that are harder to tackle.

Consider the case of the cauliflower. At my local grocery I can now purchase that particular vegetable in four different colors. In addition to the traditional white, there are orange cauliflowers, green cauliflowers, and purple cauliflowers. Guess which kind I get?

Purple cauliflower one of at least four colors now available

I’ve already shown you the range of colors carrots come in, but to me the purple ones look more exotic than white or yellow. Purple potatoes have also been touched on, but it was a while ago, so here’s the picture:

Purple potatoes with orange carrots

There are of course also purple corn chips and purple rice, and dozens of others I’m not thinking of tonight, but what got me thinking about this subject as a post over on the Agricultural Biodiversity Weblog that pointed to this story on a Kansas State sweet potato breeder who is trying to develop breeds of purple sweet potatoes suited to local commercial production. Now he’s got a motivation most of us don’t, K-state’s single school color is royal purple.*

But what about the rest of us without Purple Pride (assuming it’s not just me to thinks purple vegetables are fascinating)? What is the attraction of purple (and other unexpectedly colored) vegetables?

*In all fairness, he’s also motivated by the health benefits of increasing the consumption of the anthocyanins (the compounds than make most purple vegetables, and flowers, purple), and the financial benefits for local farmers if his purple sweet potatoes provide a way to differentiate their sweet potatoes from all the others on the market.

More purple plant photos:

The little miracle of forbidden rice. I still need to write the post on this.

It's not just corn kernels that can be purple. Some gene variants make the whole plant purple!

New York Grapes. Concords I believe, though it's been several years so I may be remembering wrong.

Scientific Name: Vitis vinifera

Supposed Genetically Engineered Trait: Large size/seedlessness

The Real Story:

Seedless grapes are descended from several different mutations that all result in the developing embryos of grape seeds to abort prematurely*. You can still find the tiny dead remnants of seeds in seedless grapes. Of course being seedless raises a new question: How do plant breeders work with seedless grapes? (And breeders definitely do work with seedless grapes. For example they’ve developed more cold tolerant seedless grapes that are well adapted to the vineyards springing up along the finger lakes in New York.)

The answer (I had to look this up myself) is that grape breeders can dissect out the seeds of immature grapes (before they abort) and use tissue culture techniques to grow them in a lab. The technique is called embryo rescue and it’s used effectively in lots of situations where plant breeders otherwise can’t get viable offspring. Once a breeder develops a tasty and hardy new breed of seedless grape, multiplying it for distribution is easy, since almost all grape vines grown today are already produced using grafting.

Normally grape seeds produce a plant hormone called gibberellin that, among many other cool roles in plant development, promotes fruit growth. Since seedless grapes, by definition, don’t have seeds, farmers often spray them with gibberellin to increase their size (otherwise seedless grapes are smaller than their seeded relatives). The enlarged seedless grapes created by gibberellin spraying are probably the cause behind uninformed comments like:

Why do “regular sized” grapes look so teeny to me? Oh that’s right, b/c the ones we have at home now are the genetically engineered ones.

Other facts about grapes:

Grapes growing outside of Prairie Moon Winery (near Ames, Iowa). Photo: rwmsn, flickr (click to view photostream)

I’ve actually fairly familiar with the grape genome, it’s one of the better assembled plant genomes and is great for doing comparisons to other eudicot species since it hasn’t gone through any further duplications since the ancient hexaploidy of eudicot plants. For example one genomic region in grape matches up to four separate regions in Arabidopsis, a species that has gone through two more recent rounds of whole genome duplication.

But enough about genomics. Grapes were originally domesticated in the Mediterranean. People have been making wine from them for thousands of years. The Odyssey talks about Odysseus and his men making wine from grapes at several points.** Wine making is still the primary use of grapes grown everywhere from famous wine regions (like California and France) to good but obscure ones (like the finger lakes of New York) to the truly unexpected wineries (like Iowa).

[This part grabbed from my previous post on grafting] Grapes are a great example of using root stocks to provide disease resistance and climate tolerance while maintaining old flavors, (and no grapes are not a tree but a woody vine). Many of the grapes grown around the world today are old breeds of European grapes that produce the various favors of wine western our culture is accustomed to, grafted on to rootstock from a separate species native to North America which provides resistance against phylloxera, an insect that devastated vineyards around the world. (Yes, disease resistance in the rootstock can sometimes provide protection for the entire plant, and no, I have no idea how it works, but I’m sure others do.)

*As with any complicated system there are a lot more ways to break grape embryo development than for it to work successfully.

**Way back in high school I used that fact to twist an otherwise mind numbingly boring english assignment into a paper on early agriculture and the biology fermentation. As I recall my english teacher was not pleased with me, but it was worth it.

I was born of illiterate parents with little means and raised in a small village without schools in west-central Ethiopia. An only child, I was nurtured with with lots of love, but on a diet less than adequate even for body maintenance, let alone for growth and intellectual development. … I was rescued by a godsend from the United State of America…

I took that quote from his testimony before the Senate Committee on Foreign relations this past spring. It was a moving call to renew the international investments in agricultural research, and the training of plant scientists around the world, something the United State and the international community as a whole have let slide for the past two decades. The whole testimony is an excellent read (h/t to mary for pointing it out on the biofortified forums). If you have a few minutes, please take the time to read the whole thing here [pdf]. If you don’t, you surely have the time to read this single paragraph:

Unfortunately, the level of support for these long term multi-generational changes[1] has declined over the last two decades, stalling the progress of our early efforts. A drop in external funding and political neglect of agriculture by national policy makes in developing countries have resulted in an increasing decline in the human capital base. Reduced funding for agriculture and agricultural research has eroded the capability of U.S. institutions to educate and conduct research in vital areas, particularly in the applied sciences including plant and animal breeding, genetics, crop physiology, and plant pathology.

Back in September, Science published a paper analyzing the effects of that drop in investment (my initial coverage of that paper is here).

I can attest to the truth of that last bit. Biology was the biggest major at the school I did my undergrad at, yet those of us studying plants in my year could probably fit around a kitchen table,* and my kind of plant biology (more basic research, less direct applications) is in much better shape than the kind we really need in the short term: applied plant biology. Right now we aren’t training nearly enough plant breeders in this country to meet even domestic needs (mostly the USDA, university extension programs, and seed companies), let alone the sort of outreach we did for the world in decades past.

Random fact I couldn’t work in anywhere else: I can proudly say I received the same training in “Genetic Improvement of Crop Plants” as plant breeders studying at the University of Ghana. Our class was video taped as part of a distance learning program, and rather than actually attend classes, most of the time I watched those video feeds. Got a good grade in the class too!

[1] Doctor Ejeta specifically mentioned the Point Four program, government funded breeding of sorghum with improved nutrition, the International Corp Research Institute for Semi-Arid Tropics, USAID, CGIAR (the parent organization of ICRISAT, as well as many other research centers), and NARS(an organization of public research organizations within different African states).

*In fairness there were more people in plant specific majors in the Ag school.

I know I'm reusing images, but this is just a really gorgeous watermelon

Scientific Name: Citrullus lanatus

Purported Genetically Engineered Trait: Lack of seeds

The Reality:

Seedless watermelons grow on triploid (three copies of every chromosome) watermelon plants. Like the banana, triploid watermelons are seedless because it’s impossible to separate three copies of each chromosome into different different reproductive cells. Unlike bananas, seedless watermelons are grown from seed and must be fertilized by fertile (diploid) watermelons to produce fruit.

Where do farmers get seeds for a seedless plant? From plant breeders who breed regular diploid (two copies of every chromosome) watermelons together with tetraploid (four copies of every chromosome) watermelons*. The seeds produced by that mating inherit two copies of each chromosome from one parents and only one copy from the other parent. The result is triploid (sterile) seed produced from two fertile parents.

About Watermelons:

A different colored watermelon. Don't know if you can see it, but the surface was an dark purple, almost black color. Those awesome anthocyanin at work again!

Watermelons were first domesticated in Southern Africa (estimated to have happened ~4000 years ago), and belongs to the same extended family of plants as cucumbers, squash, and pumpkins.

More recent breeding has developed and popularized the smaller, round watermelons you’ll often see in stores. Apparently this has been a great development for watermelon growers, as people are much more likely to buy a watermelon that can be eating in one or two sittings than the normal sized watermelons that really only make sense for a whole group.**

*Tetraploid watermelons themselves were created using colchicine, a chemical produced by several species of crocus that interferes with the proper splitting of chromosomes during plant reproduction, allowing breeders to create artificial tetraploids. In addition to their use is producing seedless fruit, artificial tetraploids are one of the ways breeders have overcoming species barriers since long before genetic engineering.

**If I tried, I’m sure I could turn that into something pseudo-profound about the loss of social connections in modern life

Some traits are easy to select for. It’s easy to tell which plants have a gene that turns them purple, or almost any of the mutants seen in the mutants of corn garden at cornell. When I was an undergrad some of the world I did was with a gene that (when it wasn’t knocked out by a transposon) turned corn kernals dark purple. Traits like that one (the R gene) that can be identified just from looking at a seed are the easiest of all.

Other traits are not so easy to select for. How do you pick out which plants in a row carry a gene variant that increases yield by 6%? Or worse yet, yields 6% more under drought conditions, but has no effect otherwise? For improving crops a plant breeder will need to track gene variants for many generations under in all sorts of growing conditions.

The solution, made possible by modern genomics and molecular biology, is to use differences in the genetics code between members of the same species to track what what happens to different pieces of DNA from one generation to the next.

Today a plant breeder can take a piece of leaf from every plant in his field*, and find out a huge amount about which parts of their genomes they inherited from which parents. So even if it’s not a dry year, he or she can still tell which plants carry the gene variant previously identified as better surviving drought. A breeder can check for dozens or hundreds of of different genes in each plant from that same small piece of leaf.

Some companies are even setting up systems to scrape little pieces off of individual corn kernals and do the same kinds of analysis. Then only the kernals with promising combinations of gene variants are planted, either further study or breeding with other kinds of corn carrying other promising traits identified and mapped by breeders.

The system can also work to discover useful new traits, something called quantitative trait mapping. A bunch of plants that are the mixed descendants of two known breeds are measured for some trait, for this example let’s use flowering time. The same plants are also analyzed using known genetic varations between their two ancestors to see which parts of their genomes come from which of the ancestral breeds. A region of the genome that contains a gene that effects flowering time will show a pattern. More of the plants which flower earliest will have inherited that region from one of their ancestors, and more of the plants which flower later will have inherited that region from the other ancestor. Regions of the genome what don’t contain genes that have an effect on when plants flower will be randomly distributed between the earlier and later flowering plants

Doing some complicated math that I don’t even want to think about can reveal regions on individual chromosomes which contains genes that control flowering time.  Depending on how much they’re able to narrow the region down, breeders will often use the regions they identify (called QTLs: quantitative trait loci) to bread improved crops without ever having to identifiy the exact gene responsible. (And flowering time can be important for breeders, for example when adapting a breed of soybeans grown in Georgia to be grown in North Dakota, a breeder will want to select for soybeans that flower faster because the growing season is shorter farther north.)

Tomorrow I’ll illustrate how genetic engineering and marker assisted breeding can be used together in the story of sub1 rice.

*I’ve worked in labs were were mused a modified paper hole puncher. The little circles it cuts out of leaves were just the right size to fit in the 1.5 mL tubes ubiquitous in molecular biology labs.