1.1 pound peach from the Berkeley Farmer's market.

Here. I had no idea anyone was even considering sequencing the peach genome until I heard a single off-hand comment at the maize meeting last month, and all of the sudden here it is. And in better shape in its first release than some genomes are even after they’re published.

This is a pre-publication release, so the Fort Lauderdale Convention is still in effect,* but the peach genome looks really great from the quick and dirty analysis I have already run. They’ve already got the genome assembled into pseudomolecules (chromosomes), unlike some genomes I could mention that have already been published, and marked the locations and structures of genes in the geneome (there was a weird period last summer when there were pre-release versions of the maize genome organized into chromosomes, and pre-release versions with the genes marked, but none that had both.)

*In short, you or I can download the peach genome, play around and study it to our hearts content, but we can’t publish anything on it until the people who actually sequenced the peach genome publish a paper describing their work.

A genetic map describes the order of markers along the chromosomes of a genome. In the oldest maps, these markers would be whole genes. Because genes that are closer together are more likely to be inherited together** by looking at the patterns of inheritance one can figure out the genetic distance between different genes.*** For example (genetic map of maize). Modern genetic maps use smaller markers, often changes in a single nucleotide (say an A turning into T or a C turning into a G) called a single nucleotide polymorphism (or SNP) between different individuals of the same species, but the principle is the same. It’s a map of the order landmarks on a chromosome along with some kind of information that can be used to tell them apart (differences in the DNA sequence itself or differences in the plants, animals, or people that carry different version of the gene).

A genome on the other hand, is the DNA sequence of each chromosome (although usually with the occasional gap). For example:

gggcactttttcgcgtttgcaagttcatggacctaagtggcacaggcgg

acaagttcaggggtcattttttcgggtttgcaagttcatggaccaaagtg

a 100 base pair segment from Sorghum bicolor chromosome 1. Of course sorghums chromosome 1 alone is more than 700,000 times as long, but to the human eye, one piece of raw sequence looks a lot like another. That’s why a genome sequence should also include data which describes which parts of the sequence actually code for genes and which parts don’t. And the end result is the data needed for a tool like CoGe to do this sort of analysis.

Yes I know I'm re-using images, but I'm just fascinated with the soybean genome this month. This compares similar sequences in four regions of the soybean genome. Notice the gene models drawn in green and blue. They were just as much a part of the soybean genome published last week as the raw sequence itself, and allow us to make much more sense out of that raw sequence. Play with this data yourself at: http://tinyurl.com/ydh95oh

For basic science today, a genome sequence is generally more useful than a genetic map. That hasn’t always been true. Barbara McClintock published a map of the order of three genes and the fact they were genetically linked to a physically observable feature on one of the maize chromosomes back in 1931****, more than twenty years before the structure of DNA was discovered. Even today, from a breeding or crop improvement perspective, a genetic map is probably more important than an actual sequenced genome, especially from a cost/benefit perspective.*****

So there’s my best attempt to explain the differences between a genetic map and a genome. But let me leave you with one final metaphor. Imagine a genetic map as the default view in google maps. It tells you were various things are located and how to get from point A to point B. A genome sequence is like clicking the “Satellite View” button. It tells you not just where things are, but what they look like, but costs a lot more to obtain (salaries of cartagraphers vs developing a space program and sending satellites into orbit).  Similarly, maps can be used to help piece satellite photos together into coverage of whole countries, and satellite photos can error check and improve the accuracy of maps.

*Artemisia annua is a kind of wormwood. Another species in the genus Artemisia absinthium provided the flavoring for absinthe, but annua‘s claim to fame is that it produces artemisinin, a crucial ingredient in next generation anti-malarial drugs that is in very short supply given annua‘s poor characteristics as a crop. A genetic map of the species holds promise for breeding new varieties that would increase production (and hopefully reduce the costs) of these life saving drugs. I’ve also got to mention that Jay Keasling, a synthetic biologist at JBEI and associated with Berkeley has engineered E. coli to produce artemisinin, with the goal of producing it much more cheaply in bioreactors than it can be harvested from plants grown in the field. It’ll be interesting to see how these two approaches play out.

**It has to do with the way the two copies of each chromosome, one inherited from each parent, are mixed together before they get passed down another generation.

***Genetic distance is measured in centi-morgans which correspond to the chances that genes won’t be inherited together. Let me put that another way. Two genes 1 centimorgan apart will be inherited 99% of the time. Two genes 25 centimorgans apart will be inherited together 75% of the time. This only hold true up to 50 centimorgans where genes are inherited together 50% of the time (this is the same as random chance or two genes on separate chromosomes) so the only way to connect genes farther than 50 centimorgans apart with mapping is to join them together based on mapping how far each gene is from to some gene in the middle. Connect enough genes together and you’ve mapped a whole chromosome. But the biggest thing to keep in mind is that centimorgans aren’t convertible into actual lengths of DNA sequence both because different species mix their chromosomes different amounts, and because different parts of a chromosome are more likely to mix (called recombining) than others. A genetic map and a genome sequence will agree on the order of genes, but not the distances between them.

****McClintock, Barbara The order of the genes C, Sh, and Wx in Zea mays with reference to a cytologically known point in the chromosome. Proceedings of the National Academy of Sciences 15 August 1931

*****Having a sequenced genome can really speed up marker discovery for building genetic maps, and genetic maps are often created during genome assembly as a way to bridge together DNA sequences separated by unsequenced gaps, so investing in either one will make it easier to eventually have both.

But first of all, let’s do this the right way this time. Here’s the paper in Nature describing the soybean genome. Here’s one of the places you can download the entire sequence from. Hopefully that establishes, beyond a reasonable doubt, that the soybean genome has, in fact, been published.

The soybean genome has doubled twice since its last common ancestor with other published genomes like grape and arabidopsis. The genome paper dates the more recent duplication as ~13 million years old and the older as ~59 million years old. When I look at homeologous* regions in soybean from the most recent genome duplication, they look more conserved than comparable regions in corn which also underwent a whole genome duplication relatively recently (the maize genome paper estimated the date at 5-12 million years ago), when one would expect a slightly older duplication to be either less conserved, or at most indistigushable from the younger. Dating genome duplications is difficult to do precisely, it’s possible the maize duplication is older and the soybean younger than current measurements suggest. It’s also possible the difference is exaggerated because comparing homeologous maize chromosomes runs into issues with the waves of transposons that have washed over the maize genome in the past ten million years. The favorite explanation I’ve thought of so far is that the different selective pressures and/or reproductive strategies of the wild ancestors of corn and soybean favored or permitted higher loss of duplicate genes in maize or selected for the avoidance of any gene loss in soybean. No idea how to test any of these ideas though…

Comparison of four homologous regions in soybean resulting from the two tetraploidies described in the soybean genome paper. Top two and bottom two are related by the recent tetraploidy, and the top and bottom pairs are related by the older tetraploidy. To load this figure live in CoGe (where you can examine the quality of the blast hits, the identity of the genes and generally have fun) visit: http://tinyurl.com/ydh95oh

After a whole genome duplication, every single gene exists as two separate copes on two different chromosomes. Generally speaking two things can happen to a pair of genes. One possibility is that both copies will be retained for either dosage reasons** or because one copy will take on a new function a change called neofunctionalization, or because each of the new gene copies has specialized in part of the job of the original gene, a change called subfunctionalization. The other, generally more common fate of duplicated genes is that one disappears from the genome. Plant genomes are dynamic places (especially compared to animal genomes, but more on that later) and sequences that don’t provide some benefit aren’t preserved for long***. A lot of my own research has to do with how a genome sheds duplicate genes, and the biases in which kinds of genes are lost and which are preserved and I find it fascinating stuff.

Anyway, to all those involved in sequencing the soybean genome, thank you for giving me even more fascinating information to study.

Previous in depth post on soybeans.

*Homeologous regions are areas of the genome that started out as duplicate copies of the same part of the genome after a whole genome duplication, but have since been evolving on their own, usually in different directions.

**If one set of genes produces a protein that works together with many other genes, doubling all of them at once has no stong effect, but if only one gene loses its extra copy, the ratios of the different proteins could end up out of balance, harming the plant. Since it’s highly unlikely that one copy of all the genes involved would be deleted at the same time, the result is that deletions or serious mutations of any of the copies of any of the genes get selected against, and the plant keeps two copies of all the genes involved for longer than other types of genes.

Think of the genome as a restaurant where there’s one person for every job (we’ll simplify it down to just a hostess, and waitress and a cook). Though it wouldn’t in the real work, hypothetically this ratio works out perfectly, the hostess can seat people fast enough to keep the waitress busy but not overwelm her and the cook is constantly cooking but orders aren’t finished late.. If suddenly the owners decide to hire another person for every job so now there are two cooks, two hostesses, and two waiteresses, everything stays in balance. Twice as many people are seated, which is just enough to be handled by two waitresses, and two cooks exactly handle the doubling of orders. But if any one of our six hypothetical people calls in sick the system breaks down. If the hostess calls in sick not enough people are seated and the waitresses, and cooks spend a lot of time just standing around. If one of the waitresses is out, the one waitress has to try to deal with twice as many constomers as she can actually handle, customers aren’t happy because of the poor quality service, and the cooks and dishwashers are still underutilized. If one of the cooks doesn’t show up, people are seated and their orders get taken promptly, but food arrives late, the cook is stressed out, and the customers are unhappy again. If a cook, a waitress, and a hostess all didn’t show up on the same day, everything would be still be in balance, but since sick days (like knock out mutations of genes) occure independently of each other, anyone not showing up to work will be bad for the restuarant, and losing a gene that functions in a complex will be bad for a plant.

***Before anyone points out transposons as a counterexample of sequences that last a long time without, usually, providing a benefit to a plant, keep in mind that because transposons are self replicating, they generate lots of copies. Most of those copies don’t last for millions of years, and almost all those that do are mangled enough by point mutations and insertion deletions that they can no longer function. Similarly when scaning through the genome it’s common to spot pseudogenes. Bits of sequence that used to be a gene, but have been destroyed by

Among the many things I’m currently missing at the Plant and Animal Genome conference, in addition to an update on the banana genome I’ve just learned (thanks to Mary over at OpenHelix) that the sequencing of the woodland strawberry genome has been completed!

I don’t know yet if the sequence has been released to the public yet. Either way I can’t find the sequence so I can’t yet comment on the quality of the sequence, or any ancient duplications in the lineage (though we already know it must share the ancient hexaploidy of the rosids, possible all eudicots).

Wild diploid strawberry (left) and domesticated octoploid strawberry (right)

What we do know is that modern domesticated strawberries are octoploid, the result of two recent whole genome duplications, but the woodland strawberry doesn’t have any duplications modern enough to be obvious from cytogenetics, visually looking at chromosomes.

Sequencing a genome is a complicated process but it started out with the work of Janet Slovin, a USDA scientist who created the inbred line* used in sequencing and seems to be the front woman from the project (Janet was kind enough to comment and point out the original article was misleading on this point, check out the link she included as well!), she’s quoted in the linked article.
And if you know how I can get my hands on the sequence please PLEASE, drop me a line at jcs98 (at) jamesandthegiantcorn (dot) com.

The single most consumed fruit in America, yet in the tropics this bananas starchy relatives play an even more vital role in feeding whole nations.

At the Plant and Animal Genome Conference next month (which I really wish I was going to), there will be a workshop on banana genomics, but from the abstract submitted by Carine Charron (h/t to Jeremy at the Agricultural Biodiversity Weblog) I learned that:

The sequencing phase will be completed in early 2010 and automatic annotation will take place during the first semester of 2010.

Why is sequencing the banana genome important? Three reasons:

• Despite their image in western cuisine, bananas (particular starchy varieties) are a vital food source for people living throughout the tropics (especially in countries like Uganda and Rwanda where bananas supply close to a third of peoples total calories in a day)
• Because most farmed bananas are sterile breeds, crop breeding (used to great effect to increase yields and disease resistance in most crops of bananas importance) is impossible. A sequenced genome will make it easier to plan and test genetic engineering approaches to increasing the diseases and stress resistance (as well as yield) of bananas.*<– I really enjoyed writing this footnote
• Banana will be the first non-grass monocot to be sequenced. Grasses evolved from the monocots, the same way that birds evolved from dinosaurs. You can’t define a common ancestor of all dinosaurs that isn’t also the ancestor of birds.**

The ancestor of all grasses from turfgrass to corn to bamboo, probably had more in common with this dwarf banana than its wildly successful descendants

As someone who studies grass genomes, the chance to see what the genomes of monocots looked like before the big evolutionary breakthroughs that lead to grasses (one of the younger and most successful groups of plants on the face of the planet if I do say so myself***) is like a bird scientist getting a chance to sequence the genome of a dinosaur species that had somehow survived to the present day. Yes, with only one non-grass monocot genome it’ll be hard to stay which parts represent banana specific changes and which parts are unchanged from the common ancestor of all monocots, but it’ll still be way more than we know today.

The banana genome has been promised before, this story from back in 2001 claimed it would be sequenced in less than five years and been the third genome ever sequenced. But this time it’s actually happening. The sequence data is pouring in, the assembly (putting pieces of the genome together like a giant jigsaw puzzle) and annotation (figuring out which pieces of the genome are actually genes) will soon begin if they haven’t already.

My thanks and appreciation go out to the scientists involved in the complex effort sequencing the banana genome entails (and before that the possibly even more complex effort of getting funding to pay for the sequencing). I know you’re doing it for the people who depend on bananas for food, but you’re making my work as a comparative genomicist even more interesting than it already was (something that seems almost impossible).

If you’re interested in bananas check out my previous posts on the history of the banana and banana biology.

*In fact a lot of the work scientists have done studying the genetic changes that have been selected for during domestication of crops like corn could be leveraged to introduce similar changes in banana. One example is the selection for corn that doesn’t compete as much with its neighbors (reduced shade avoidance response), leaving more energy left over for producing a large ear. The same trait has been selected for in many crops that reproduce sexually. Norman Borlaug’s dwarf wheat is an extreme example of the same principle (although it that case there were also benefits to nitrogen use efficiency). If similar changes were introduced to bananas, farmers would be able to plant bananas closer together and produce more bananas per acre. That sort of change is the closest to a free lunch as you’re going to get in ag research.

**People who study how species are related to each other get very annoyed when anyone starts taking about groups of species that doesn’t have a common ancestor that isn’t the ancestor of any other species not in the same group (such bad groupings are called paraphyletic clades but don’t worry that name isn’t going to be on the midterm). To them birds ARE dinosaurs, because otherwise looking at the group of non-bird dinosaurs is defining a paraphyletic group. For the same reason grasses ARE monocots. I understand why defining groups properly is important to them, and it generally will make biology make more sense, but sometimes I do need to talk about paraphyletic groups like non-grass monocots.

***For most intents and purposes, grasses didn’t exist when dinosaurs walked the earth, yet today grasslands cover 20% of the earth’s land area, and along the way the productivity of key crops like corn, wheat, and rice (all grasses) creating the surpluses of food enabled human civilization.

Sequencing the maize genome took four years and 30 million dollars. Today Virginia Tech announced the University of Minnesota and themselves had received a $908,000 grant to sequence the Turkey genome in two years. I don’t know how big or complex the turkey genome is, but the idea of sequencing a whole new species for less than a million dollars is still pretty cool.

h/t to 538 they’ve got more cool turkey statistics over there.

Estimates at the time ranged from 40,000 to 150,000 genes. Then the draft genome was published and estimates drop to 30,000-40,000 range. The final genome paper comes out and estimates drop even further. Fast forward to today and the latest annotations show the human genome contains a mere 23,000 genes. I’m sorry. I know we want to feel special, the very pinnacle of evolution.* But at least when it comes to gene count, we’re not. If comparing our own genome to that of Arabidopsis thaliana (the first plant genome to be sequenced, contained 27,000 genes) didn’t drive that home, the second plant genome sequenced, rice, with its 40,577 non-transposon related genes surely made the point.

Yet somehow every time a new plant genome comes out, as the corn genome did this week, it’s big news that it has more genes than our own. Maybe this is partially because journalists have trouble understanding the true impact of this research and it’s an easy fact to latch on to. But I think at least part of it is that we still take it personally that our genomes don’t respect our special-ness as a species.

If it makes you feel any better, think about it this way. Plants have to observe and react to their environments intelligently in order to survive. So does every living thing. But plants don’t contain a single nerve cell. They can’t learn. edit: (with some caveats see the comment section). Every aspect of every reaction to every stimuli, from lack of water, to out competing neighbors, to an excess of boron (yes, there are people who study genetic variation in plant’s ability to survive in high boron soils) must be hard coded into their DNA. It’s one of the big reasons I love studying plant genomics. Everything about a plant is in there, we just have to know enough to understand it. (Though my hard learned advice is not to spend too much time talking about how wonderful it is not to have to worry about cognitive science and neurobiology when dealing with people who work in animal systems.)

*Nevermind that evolution doesn’t actually have a pinnacle just countless branches.

You know I could keep talking about the maize genome all day (and I may very well do just that), but what are other bloggers saying about the most complicated plant genome ever published, of second most important single species for feeding people around the world? (Clearly I’m not at all excited)

Mary over at Openhelix is excited about the study of differences in the number of copies of genomes between different maize plants, including genes that are found in some corn, but completely missing in others, as well as the fact 85% of the corn genome is made up of transposons (selfish dna).

A lot of bloggers seem to be surprised that corn has more genes than humans, which means they must have missed the original shock when arabidopsis, one of the smaller, least exciting (at least to non-biologists) plants out there, was the first plant to have its genome sequenced and beat out humans for number of genes ~27,000 to ~23,000.  Shhh… nobody tell those people that rice has over 40,000 genes or they’ll REALLY develop an inferiority complex. Plant genomes are excitingly complicated. It’s one of the reasons I love studying them so much.

I’ve also found some people who seem to think different colors of corn are from different species:

blue and dark/black corn are the original ones and the more nutrius , i belive yellow is the domisticated one and favourd by farmers for its “easy” growth

I’m pretty sure people like that are not reading my blog, but I thought I’d warn the people who do read that this meme is alive and multiplying in the wild*

But the most refreshing views I’ve come across in my search for reactions to the publication of the maize genome are exemplified in this title from Corn Commentary: “Let’s Hear a Cheer for the Guys in Lab Coats!” Since I personally had nothing to do with the sequencing of the maize genome, I hope no one will take it as self congratulation to say: I completely agree! (As if you couldn’t tell my views on the subject from the wave of posts I’m putting up today.)

*For the record, color of corn is controlled by a handful of genes, and often the change of even a single gene can result is drastically different colors. Most of the corn grown in the US today is yellow as a result of a gene that promotes the accumulation of beta-carotene in the kernals themselves. Breeders introgressed that version of the gene into most of the corn grown in the US which makes corn marginally more nutritious. It’s basically a much less concentrated version of what happens in golden rice. While normal yellow corn doesn’t make that much difference, breeders are currently developing lines of corn with so much beta carotene they’re bright orange (some of the credit for this work goes to Cornell). If the decades plant breeders spent searching for similiar natural variation in rice had payed off, golden rice would be saving lives right now around the world instead of still being tied up by the incredible scrutiny given to any crop developed using genetic engineering.

A single maize ear with kernals of two colors resulted from different versions of a single gene (c1). Photo credit: MaizeGDB

Yellow and white corn kernals on the same ear. The difference is controlled by a gene named y1.

The fact that these genes have have single letter appreviations followed by the number 1 should give you a sense of just how long ago maize geneticists started studying them. If I go out and discover a cool new phenotype in maize tomorrow, it’d probably end up with a name like rgd17 (my apologies if there already is an rgd17 gene).

Lots of corn … and maybe some genomics. Consider yourselves forwarned!